Chemokines CCL2/MCP-1 and CXCL12/SDF-1 are both produced by BMEC and their expression and/or localization is altered during MS/EAE in ways to facilitate leukocyte infiltration of the CNS and further BBB compromise [71, 118C121]. 4% paraformaldehyde, and then immunostained for the TJ protein occludin. Fig. S3. TJ protein/gene expression in hES-MSCs and BM-MSCs. A. hES-MSCs and BM-MSCs were grown in the 8-well chamber slides coated with 0.1% gelatin. At confluence, hES-MSCs and BM-MSCs were fixed with 4% paraformaldehyde, and then immunostained for TJ proteins CLN-5, ZO-1 and occludin. B. hES-MSCs and BM-MSCs, grown as described in A, were subect to total RNA extraction for relative measurement of CLN-5, ZO-1 and occludin mRNA by qRT-PCR (B). Data are presented as mean??SE.. Each experiment consisted of 3 replicates (derived from a single preparation of MSCs) repeated 3 times (each time from a different MSC preparation), for a total N?=?9 samples per group. Ct values, and not relative expression values are reported, as Ct values for BM-MSC CLN-5 and occludin mRNA were? ?35 and, thus, not considered detectable. *for 10?min at 4?C, 2000for 10?min at 4?C, 8000for 30?min at 4?C to remove whole cells, large cell fragments, and apoptotic bodies, respectively. The clarified supernatant was then spun at 100,000for 60?min at 4?C to pellet both exosome and microvesicle EV subtypes. EVs were then extracted in cell lysis buffer (Signosis, Santa Clara, CA) and an aliquot directly subject to qRT-PCR as detailed [76]. qRT-PCR Total RNA was extracted from cell cultures using the RNeasy kit (QIAGEN, Mansfield, MA) according to the manufacturers instructions. RNA was treated with Turbo DNase (Ambion, Austin, TX)?according to the protocol provided by the manufacturer, and cDNA synthesized from total RNA using the SuperScript III first-Strand synthesis system (Invitrogen) standard protocol with random hexamers (Roche, Indianapolis, IN), extension temperature at 42?C for 60 min. Resulting cDNA was stored at ??80?C until used for further analysis. Measurements of cDNA levels were performed by qRT-PCR using an ABI PRISM 7500 Sequence Detection System Version 1.3, and SYBR green (ABI) fluorescence was used to quantify relative amplicon amount. RPL-19 was used as reference for relative gene expression. Relative quantification was performed using the 2 2?Ct method of Fleige et al. [77]. RT negative controls and no-template controls NBR13 showed negligible signals (Ct value? ?40). Melting curve analysis was used to ensure reaction specificity. RNA expression is reported as x-fold of control??S.E. The RNA level from EV is reported as Ct value. Sequences of primers used are indicated in Table?1 and Additional CTP354 file 1: Table S1. Table?1 List qRTCPCR mouse primer sequences thead th align=”left” rowspan=”1″ colspan=”1″ Gene /th th align=”left” rowspan=”1″ colspan=”1″ Forward (5C3) /th th align=”left” rowspan=”1″ colspan=”1″ Reverse (5C3) /th /thead RPL-19CGCTGCGGGAAAAAGAAGCTGATCTGCTGACG GAGTTGCLN-5TGCCGCGAACAGTTCCTACCCAGCTGCCCTTTCAGGTTAZO-1CTCGGAAAAATGAAGAATATGGTCCACCATCTCTTGCTGCCAAAOccludinGGACTGGGTCAGGGAATATCCGCAGACCTGCATCAAAATTTCTCVE-cadherinCACTGCTTTGGGAGCCTTCGGGGCAGCGATTCATTTTTCTICAM-1GGTGACTGAGGAGTTCGACAGAAACCGGAGCTGAAAAGTTGTAGACTVCAM-1GTGACTCCATGGCCCTCACTCGTCCTCACCTTCGCGTTTACCL2GGCTCAGCCAGATGCAGTTAACC GCCTACTCATTGGG TCACXCL12GCTCCTCGACAGATGCCTTGGACCCTGGCACTGAACTGGA Open in a separate window Western blotting bEND.3, hES-MSCs and hES-MSCCderived EVs were solubilized in 8?M urea containing protease inhibitor cocktail (Sigma). Protein concentration was assayed by the Micro BCA protein assay kit (ThermoFisher Scientific, Grand Island, NY). Lysates containing 15?g of bEND.3, hES-MSC or hES-MSCCderived EV protein were separated by electrophoresis on 4C20% Mini-PROTEAN? TGX? Precast SDS-PAGE gels and transferred onto PVDF membranes (Bio-Rad Laboratories, Hercules, CA). Membranes were then blocked CTP354 with 5% bovine serum albumin (BSA) in Tris-buffered saline with Tween-20 (TBST) (ThermoFisher Scientific, Grand Island, NY) for 1?h at room temperature, followed by incubation overnight at 4?C with the CLN-5 antibody (1:200; Life Technologies, Carlsbad, CA) diluted in 5% BSA in TBST. Following incubation with anti-mouse HRP-conjugated secondary antibody (1:400; Cell Signaling), blots were developed using the chemiluminescent HRP substrate kit (SuperSignal West Pico Chemiluminescent Substrate, ThermoFisher Scientific, Grand Island, NY) and signal detected using a G:Box XX6 digital gel imager (Syngene, Frederick, MD). Images were acquired by GeneSys software (Syngene). Since there is not yet consensus in the literature on an internal loading protein control for extracellular vesicles (EVs), nor a protein generally recognized that is equally present in bEND.3 cells, hES-MSCs, and hES-MSC-derived EVs, a loading control was not included. Instead, equal amounts of total protein were loaded. Transendothelial migration assay Both hES-MSCs and BM-MSCs were labeled with red fluorescent membrane dye PKH-26 (Life Technologies, Carlsbad, CA). Briefly, all MSCs were plated on gelatin coated 6-well plates and, after reaching confluence, were trypsinized, spun down, and resuspended in 500?l DMEM. Cells were then incubated with PKH26 dye (2??10?6?M) CTP354 at room temperature for 5?min according to manufacturers instructions, followed by washing with PBS. BMECs were sub-cultured at 2.5??105 cells/cm2 onto Transwell filter inserts (24-well format, 8.0-m pore, Costar) that had been previously coated with a hydrated layer of collagen I (BD Bioscience) and IV, as described [78]. PKH26-labeled hES-MSCs and BM-MSCs were added to the top chamber at a density of 1 1.0??104 cells/cm2, and.